Creature

My Creature's Genotypes:
-Number of Eyes (EE)- one eye
-Tail (Tt)- Has a tail
-Body Shape(rr)- Circle
-Color of Hair (G) - Brunette
-Teeth (XtXt)- Female, buck teeth
-Color of body (aa)- White

Easter Bunny

ATGCGCTAGCTAGTGCCGAAGGCTCGGACGGATCTATCAGCGCGTGCTACTGGTAGATCGGCTGAGACGTAGTCGTGCTAGATCACAGTGTAGCGGACGCATCGAGAC

TACGCGATCGATCACGGCTTCCGAGCCAGCCTAGATAGTCGCGCACGATGACCATCTAGCCGACTCTGCATCAGCACGATCTAGTGTCACATCGCCTGCGTAGCTCTG

Debate

Topic: PRO: Infants should be genetically screened for Huntington's disease.
3 Sources:

• http://wordnetweb.princeton.edu/perl/webwn?s=huntington's%20disease

What is Huntington's disease? a hereditary disease which develops in adulthood and ends in dementia.

• Article

-Eash offspring has a 50% chance of inheriting the condition.
-Not a recessive disorder.
-Testing for Huntington's disease became available with the discovery of the HD gene on one tip of chromosome four.
-Usually older people who decide to get tested.

• http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1016454/

-Women who said that prenatal testing was OK said that they would be reluctant to inform their employer or insurer.
-About one quarter of the group would choose to terminate the pregnancy if they found out their baby was positive for HD. However, I think that this is an eratic behavior and the child can still live their life to the fullest.

• http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1125190/

Hypothetical Case
A woman who is eight weeks pregnant discovers that her partner is at 50% risk of developing Huntington's disease. He is not interested in pursuing predictive testing. The woman is adamant that she does not want a child who will develop Huntington's disease in later life, and she requests a prenatal test.

There is a 1 in 4 chance that the prenatal test will show that the fetus has the mutation for Huntington's disease, and therefore the test also presymptomatically diagnoses the father. Such prenatal requests highlight the uncertainty of the legal position taken by the international guidelines. Cases like this pose considerable ethical and legal dilemmas for clinicians. Does the right of the pregnant mother to know the status of her fetus outweigh the right of the father at risk to not know his genetic status?

I believe so because the mother is the one carrying the baby and she does not necessarily have to tell the father the results which means he will not have to know if he has it.